ID: 1199991423_1199991429

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1199991423 1199991429
Species Human (GRCh38) Human (GRCh38)
Location X:152989700-152989722 X:152989735-152989757
Sequence CCCTCATGCAGTGTAGATGATCC GGACCCTGTGGCCTCCCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 80} {0: 1, 1: 0, 2: 3, 3: 45, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!