ID: 1200002360_1200002370

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1200002360 1200002370
Species Human (GRCh38) Human (GRCh38)
Location X:153068636-153068658 X:153068675-153068697
Sequence CCTGTGCTTTGGGGCCAGCTGAA GAATGTGGTGAGAGGAGCTGGGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 4, 3: 42, 4: 541}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!