ID: 1200003195_1200003206

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1200003195 1200003206
Species Human (GRCh38) Human (GRCh38)
Location X:153072530-153072552 X:153072562-153072584
Sequence CCGCCGCCGCAGCGGCGCGCAGC GCCCTGTGGGGACCCGGACCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 30, 4: 272} {0: 2, 1: 0, 2: 2, 3: 13, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!