ID: 1200028299_1200028305

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1200028299 1200028305
Species Human (GRCh38) Human (GRCh38)
Location X:153276989-153277011 X:153277013-153277035
Sequence CCAACCTGCACCATGGAAAGCGG GCATTCAAGTTCCTCTTCGAAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 6, 4: 87} {0: 2, 1: 0, 2: 0, 3: 6, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!