ID: 1200034800_1200034812

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1200034800 1200034812
Species Human (GRCh38) Human (GRCh38)
Location X:153320313-153320335 X:153320348-153320370
Sequence CCTGCTTCACCTGCACCTCTGGC CTGGGGCTGTGCAGGGAAACTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 493} {0: 1, 1: 3, 2: 11, 3: 65, 4: 493}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!