ID: 1200045888_1200045894

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1200045888 1200045894
Species Human (GRCh38) Human (GRCh38)
Location X:153400922-153400944 X:153400938-153400960
Sequence CCGCGTGCTTGGCGACCCTCTCC CCTCTCCGCCCAGGGACCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 20, 4: 235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!