ID: 1200053018_1200053030

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1200053018 1200053030
Species Human (GRCh38) Human (GRCh38)
Location X:153444728-153444750 X:153444780-153444802
Sequence CCAGGCTGGGGTCATCAGGCGGC ACGGGCCTGCTCATCGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 139} {0: 1, 1: 0, 2: 0, 3: 4, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!