ID: 1200053318_1200053335

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1200053318 1200053335
Species Human (GRCh38) Human (GRCh38)
Location X:153445967-153445989 X:153446015-153446037
Sequence CCCGGGGAGACTGTCCTTGCCAA CGGGCACTGACCGGCTTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 148} {0: 1, 1: 0, 2: 1, 3: 4, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!