ID: 1200083664_1200083673 |
View in Genome Browser |
Spacer: 12 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1200083664 | 1200083673 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:153592254-153592276 | X:153592289-153592311 |
| Sequence | CCTCCTCCCGGGACACCGGCGAC | CAGCACTCCTGTTCGACATCCGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 0, 3: 8, 4: 119} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||