ID: 1200083664_1200083673

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1200083664 1200083673
Species Human (GRCh38) Human (GRCh38)
Location X:153592254-153592276 X:153592289-153592311
Sequence CCTCCTCCCGGGACACCGGCGAC CAGCACTCCTGTTCGACATCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 126} {0: 1, 1: 0, 2: 0, 3: 8, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!