ID: 1200084807_1200084821

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1200084807 1200084821
Species Human (GRCh38) Human (GRCh38)
Location X:153598942-153598964 X:153598988-153599010
Sequence CCTCCCCCGGCCGCGGTTACCTG CGGAAGTGCACCCTGGCTTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 164} {0: 3, 1: 1, 2: 2, 3: 3, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!