ID: 1200093862_1200093874

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1200093862 1200093874
Species Human (GRCh38) Human (GRCh38)
Location X:153648190-153648212 X:153648226-153648248
Sequence CCTGTACGACCAGGGCGGGGGCC GGAGGCCGAGGCCGAGGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 71} {0: 4, 1: 17, 2: 39, 3: 319, 4: 1359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!