ID: 1200093862_1200093878

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1200093862 1200093878
Species Human (GRCh38) Human (GRCh38)
Location X:153648190-153648212 X:153648235-153648257
Sequence CCTGTACGACCAGGGCGGGGGCC GGCCGAGGCCGAGGAGTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 71} {0: 1, 1: 0, 2: 3, 3: 55, 4: 559}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!