ID: 1200100672_1200100691

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1200100672 1200100691
Species Human (GRCh38) Human (GRCh38)
Location X:153688060-153688082 X:153688102-153688124
Sequence CCGCCACCACCGCCACCGGAGTC TCCGCGGGCCCCGGCCGGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 14, 3: 66, 4: 732} {0: 1, 1: 1, 2: 1, 3: 38, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!