|
Left Crispr |
Right Crispr |
| Crispr ID |
1200100712 |
1200100726 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
X:153688154-153688176
|
X:153688201-153688223
|
| Sequence |
CCGCCGCTTGCAGACCGCGGGCG |
GCTGAGCCTCGGGTCGGGCGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 2, 3: 2, 4: 54} |
{0: 1, 1: 3, 2: 1, 3: 33, 4: 195} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|