ID: 1200100885_1200100904

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1200100885 1200100904
Species Human (GRCh38) Human (GRCh38)
Location X:153688665-153688687 X:153688717-153688739
Sequence CCGGCCAAGGGCGACGGCCCCGT CCGTGCCGCCGCGCGAGACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 56} {0: 1, 1: 0, 2: 0, 3: 9, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!