ID: 1200101011_1200101020 |
View in Genome Browser |
Spacer: 19 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1200101011 | 1200101020 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | X:153689031-153689053 | X:153689073-153689095 |
| Sequence | CCTGGCATGGTGGGGGGAGGGGG | TGCCCCCCAGACTCCCGGGCTGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 2, 2: 26, 3: 198, 4: 1784} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||