ID: 1200105307_1200105314

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1200105307 1200105314
Species Human (GRCh38) Human (GRCh38)
Location X:153708807-153708829 X:153708827-153708849
Sequence CCCCAAAGGGCTGCCCCAAGTCC TCCATTTTGGTACAGCTGCGTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 0, 3: 16, 4: 277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!