ID: 1200105952_1200105957

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1200105952 1200105957
Species Human (GRCh38) Human (GRCh38)
Location X:153712542-153712564 X:153712575-153712597
Sequence CCGTGGTTAACTTTTTTTAAACA TTTAAAAAGCATGTGGAGGCTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 4, 3: 70, 4: 593} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!