ID: 1200107855_1200107870

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1200107855 1200107870
Species Human (GRCh38) Human (GRCh38)
Location X:153724654-153724676 X:153724686-153724708
Sequence CCCACGTCTCTGTGGTGCGGGAG CGAGGGGCGAGAACGGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76} {0: 1, 1: 0, 2: 3, 3: 19, 4: 356}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!