ID: 1200109813_1200109820

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1200109813 1200109820
Species Human (GRCh38) Human (GRCh38)
Location X:153734662-153734684 X:153734681-153734703
Sequence CCCCAGGAGGGGCGACATCAGTG AGTGGTGCAGGACAGAGGGCCGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 32, 4: 430}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!