ID: 1200115724_1200115731

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1200115724 1200115731
Species Human (GRCh38) Human (GRCh38)
Location X:153768937-153768959 X:153768953-153768975
Sequence CCCCCACTCAGGTCTTTCTCCAC TCTCCACGGCTCCCAGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 295} {0: 1, 1: 0, 2: 4, 3: 32, 4: 321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!