ID: 1200116305_1200116318

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1200116305 1200116318
Species Human (GRCh38) Human (GRCh38)
Location X:153771176-153771198 X:153771214-153771236
Sequence CCTCTGTCTGTGGGCCCCAGTCT GAACAATCACATTCATTCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 47, 4: 348} {0: 1, 1: 0, 2: 0, 3: 11, 4: 238}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!