ID: 1200118682_1200118686

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1200118682 1200118686
Species Human (GRCh38) Human (GRCh38)
Location X:153780539-153780561 X:153780566-153780588
Sequence CCAGTTGTCCTAGGGGCTGATGA TAGAAGAAGCAGGAAGTGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 44, 4: 563}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!