ID: 1200128738_1200128755

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1200128738 1200128755
Species Human (GRCh38) Human (GRCh38)
Location X:153830146-153830168 X:153830184-153830206
Sequence CCCGCTCTCCCACGCCCGCCGCT GGCCCGCTCCTCCCCGCGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 310} {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!