ID: 1200128750_1200128764

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1200128750 1200128764
Species Human (GRCh38) Human (GRCh38)
Location X:153830177-153830199 X:153830210-153830232
Sequence CCCCACTGGCCCGCTCCTCCCCG CGCCCCCGCCGCAGCGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 449} {0: 1, 1: 2, 2: 3, 3: 44, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!