ID: 1200128769_1200128774

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1200128769 1200128774
Species Human (GRCh38) Human (GRCh38)
Location X:153830218-153830240 X:153830246-153830268
Sequence CCGCAGCGCCGGCGGCCCTACCT ATCACTTTGTACTGCTCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 123} {0: 1, 1: 0, 2: 1, 3: 12, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!