ID: 1200136528_1200136539

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1200136528 1200136539
Species Human (GRCh38) Human (GRCh38)
Location X:153877762-153877784 X:153877792-153877814
Sequence CCTTCCAGATGCTCCAGGTTAGG CAGGGGTCAGGACAAGCTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 26, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!