ID: 1200150186_1200150194

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1200150186 1200150194
Species Human (GRCh38) Human (GRCh38)
Location X:153947464-153947486 X:153947493-153947515
Sequence CCTCCAGGGGGCTCCCGTGAGCC AGGTCTCAGCCTTCCCGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 67, 4: 246} {0: 1, 1: 0, 2: 0, 3: 13, 4: 128}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!