ID: 1200151318_1200151323

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1200151318 1200151323
Species Human (GRCh38) Human (GRCh38)
Location X:153952754-153952776 X:153952771-153952793
Sequence CCACCACCGCAGAGCCGGCAGAC GCAGACTCCTGGCCCGAAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 121} {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!