ID: 1200155474_1200155484

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1200155474 1200155484
Species Human (GRCh38) Human (GRCh38)
Location X:153972533-153972555 X:153972561-153972583
Sequence CCGCCCTCGGGCGCCACCGCCTC GCGCCGCAGCAAAATGAGCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 316} {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!