ID: 1200163099_1200163104

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1200163099 1200163104
Species Human (GRCh38) Human (GRCh38)
Location X:154019243-154019265 X:154019258-154019280
Sequence CCAGGCCTCGGCCTCGGCGGGTG GGCGGGTGCAGGGATGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 198} {0: 1, 1: 1, 2: 1, 3: 46, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!