ID: 1200177194_1200177207

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1200177194 1200177207
Species Human (GRCh38) Human (GRCh38)
Location X:154125482-154125504 X:154125533-154125555
Sequence CCGCTCCGCAGCAGCCTCGTGGT AGGGAGGGCACGGTGACTGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 13, 3: 84, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!