ID: 1200214974_1200214991

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1200214974 1200214991
Species Human (GRCh38) Human (GRCh38)
Location X:154364219-154364241 X:154364258-154364280
Sequence CCCACACCTGCCCTGCCCCCAAC CCTGGACTTGGACCCGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 96, 4: 946} {0: 1, 1: 1, 2: 0, 3: 14, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!