ID: 1200214976_1200214989

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1200214976 1200214989
Species Human (GRCh38) Human (GRCh38)
Location X:154364225-154364247 X:154364257-154364279
Sequence CCTGCCCTGCCCCCAACACCCGT ACCTGGACTTGGACCCGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 59, 4: 630} {0: 2, 1: 0, 2: 0, 3: 4, 4: 79}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!