ID: 1200214987_1200214995

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1200214987 1200214995
Species Human (GRCh38) Human (GRCh38)
Location X:154364244-154364266 X:154364277-154364299
Sequence CCGTGGGTGCTCTACCTGGACTT TGGGGCCTTGCCACCGTGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 118} {0: 1, 1: 0, 2: 0, 3: 17, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!