ID: 1200215993_1200216002

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1200215993 1200216002
Species Human (GRCh38) Human (GRCh38)
Location X:154368526-154368548 X:154368550-154368572
Sequence CCATGACCTGGAGTGGGGCTGGG CTGAGGAAGAGGAAGGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 425} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!