ID: 1200216751_1200216769

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1200216751 1200216769
Species Human (GRCh38) Human (GRCh38)
Location X:154371479-154371501 X:154371525-154371547
Sequence CCCGTTGGAATGCCCCCACTAGG GCGAAACCCGGGCTCCAGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 59} {0: 1, 1: 0, 2: 0, 3: 12, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!