ID: 1200217533_1200217550

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1200217533 1200217550
Species Human (GRCh38) Human (GRCh38)
Location X:154374679-154374701 X:154374720-154374742
Sequence CCCGCGCCCGCCCCGCGCCCGGC CTTAATTGGTAAAATTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 40, 3: 301, 4: 1772} {0: 1, 1: 0, 2: 1, 3: 7, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!