ID: 1200224805_1200224819

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1200224805 1200224819
Species Human (GRCh38) Human (GRCh38)
Location X:154411624-154411646 X:154411668-154411690
Sequence CCCGGCGACCGCTCCCCAGTGAC GCTCCGGCCTGACCTGCGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85} {0: 1, 1: 0, 2: 1, 3: 4, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!