ID: 1200232018_1200232023

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1200232018 1200232023
Species Human (GRCh38) Human (GRCh38)
Location X:154448839-154448861 X:154448854-154448876
Sequence CCCCAAGGCTGCTCTCAGTGGGG CAGTGGGGCTGGAGACCAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 242} {0: 1, 1: 0, 2: 4, 3: 39, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!