ID: 1200234463_1200234473

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1200234463 1200234473
Species Human (GRCh38) Human (GRCh38)
Location X:154461624-154461646 X:154461661-154461683
Sequence CCCTGCATCAACACCGTGAGCCC CTGGTCCTCTGCCCTGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83} {0: 1, 1: 0, 2: 7, 3: 49, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!