ID: 1200235082_1200235094

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1200235082 1200235094
Species Human (GRCh38) Human (GRCh38)
Location X:154464251-154464273 X:154464286-154464308
Sequence CCGGTGAACTGCTCTGCCCCTCA GAGCTCCGAGCTCTTACCAGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 265} {0: 1, 1: 0, 2: 0, 3: 7, 4: 82}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!