ID: 1200238080_1200238088

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1200238080 1200238088
Species Human (GRCh38) Human (GRCh38)
Location X:154478759-154478781 X:154478782-154478804
Sequence CCGCAGACGCGGCGTCTCTGCCC GGACCTGGCGCGTGCGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 91} {0: 1, 1: 0, 2: 0, 3: 10, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!