ID: 1200244649_1200244664

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1200244649 1200244664
Species Human (GRCh38) Human (GRCh38)
Location X:154516411-154516433 X:154516461-154516483
Sequence CCACCTCCGCAGTGCGTTCAGGC GGCCCACGTCGGTCCCGCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!