ID: 1200246689_1200246698

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1200246689 1200246698
Species Human (GRCh38) Human (GRCh38)
Location X:154530284-154530306 X:154530328-154530350
Sequence CCCTCTGAAAACTCAAGAGGTGC GAAGAGCAAGAATTGAACACCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 154} {0: 1, 1: 0, 2: 5, 3: 43, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!