ID: 1200246721_1200246723

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1200246721 1200246723
Species Human (GRCh38) Human (GRCh38)
Location X:154530447-154530469 X:154530460-154530482
Sequence CCTCACCTGTGCTGCGGGTGGAA GCGGGTGGAACACTCCTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 550} {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!