ID: 1200253654_1200253667

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1200253654 1200253667
Species Human (GRCh38) Human (GRCh38)
Location X:154567763-154567785 X:154567798-154567820
Sequence CCACCGCCCTGCCCGGAGGTGGG CTCCTCCGGTAGCACAGTGTAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 33, 4: 347} {0: 2, 1: 0, 2: 2, 3: 3, 4: 77}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
12 X:154636610-154636632 CCTACACTGTGCTACCGGAGGAG - X:154636645-154636667 CCCACCTCCGGGCAGGGCGGTGG +
12 X:154567763-154567785 CCACCGCCCTGCCCGGAGGTGGG - X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG +