ID: 1200253660_1200253667

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1200253660 1200253667
Species Human (GRCh38) Human (GRCh38)
Location X:154567774-154567796 X:154567798-154567820
Sequence CCCGGAGGTGGGGCTGCCTCCTC CTCCTCCGGTAGCACAGTGTAGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 8, 3: 75, 4: 484} {0: 2, 1: 0, 2: 2, 3: 3, 4: 77}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
1 X:154636610-154636632 CCTACACTGTGCTACCGGAGGAG - X:154636634-154636656 GAGGAGGCAGCCCCACCTCCGGG +
1 X:154567774-154567796 CCCGGAGGTGGGGCTGCCTCCTC - X:154567798-154567820 CTCCTCCGGTAGCACAGTGTAGG +
346 6:73263104-73263126 GAGGAGACAGCGGTACCTCCTGG + 6:73263473-73263495 CCAGGCTGTGGGGCTGCCTCTTC -