ID: 1200259592_1200259598

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1200259592 1200259598
Species Human (GRCh38) Human (GRCh38)
Location X:154605983-154606005 X:154606028-154606050
Sequence CCAAACAATGCACGTCTGCTGTG TGATGCTCTCAGAGTCATCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76} {0: 1, 1: 0, 2: 3, 3: 20, 4: 171}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
22 X:154605983-154606005 CCAAACAATGCACGTCTGCTGTG - X:154606028-154606050 TGATGCTCTCAGAGTCATCTCGG +