ID: 1200274169_1200274176

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1200274169 1200274176
Species Human (GRCh38) Human (GRCh38)
Location X:154716228-154716250 X:154716281-154716303
Sequence CCGGATGGGCTTGCTGGAGTGCT TGCCGCTCATGCGGCCTCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143} {0: 1, 1: 0, 2: 0, 3: 4, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!